Source code for rna_pdb_tools.BlastPDB

#!/usr/bin/env python
# -*- coding: utf-8 -*-

try:
    import urllib3
except:
    print('BlastPDB requires urllib3')


[docs]class BlastPDB: """BlastPDB - run Blast online on the PDB database. This can be used in Jupiter based RNA notebooks, e.g. https://github.com/mmagnus/rna-pdb-tools/blob/master/rp18.ipynb Usage:: >>> p = BlastPDB('GGGUCAGGCCGGCGAAAGUCGCCACAGUUUGGGGAAAGCUGUGCAGCCUGUAACCCCCCCACGAAAGUGGG') >>> p.search() >>> p.result #doctest: +ELLIPSIS u'<HTML>\\n<TITLE>BLAST Search Results</TITLE>... :param seq: string """ def __init__(self, seq): self.seq = seq self.result = ''
[docs] def search(self): """Search online the seq.""" http = urllib3.PoolManager() response = http.request('GET', 'http://www.rcsb.org/pdb/rest/getBlastPDB1?sequence=' + self.seq + '&eCutOff=10.0&matrix=BLOSUM62&outputFormat=HTML') if response.status == 200: self.result = response.data.decode()
# main if __name__ == '__main__': import doctest doctest.testmod()